robert-boehnke (u/robert-boehnke)

robert-boehnke commented on We're wasting money by only supporting gzip for raw DNA files bioinformaticszen.com/pos... · Posted by u/michaelbarton

actually_a_dog · 3 years ago

To put that in perspective, consider that a large portion of the file is literally a nucleotide sequence, e.g. "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC" and that the rest of the file format is also fairly repetitive. If we just imagine only the nucleotide sequence, one way to compress that would be to take advantage of going from an 8 bit alphabet (ASCII encoding) to a 4 bit alphabet (CGAT). Naively, you'd expect ~50% compression from that alone, and be left with a bit stream that's still compressible.

robert-boehnke · 3 years ago

Wouldn't you only need two bits to encode C, G, A, and T?

robert-boehnke commented on SwiftUI in 2022 mjtsai.com/blog/2022/05/2... · Posted by u/mpweiher

robert-boehnke · 3 years ago

I'm writing a component library[1] on top of SwiftUI and while there are ton of unsolved problems in SwiftUI, the separation of concern allows for much more productive workflows than were ever commonplace in UIKit.

We're dropping into UIKit land quite frequently but for the user of the API, that remains implementation detail and while likely change as SwiftUI advances.

Ironically, a "Stock iOS" style app like Mail or Contacts is much harder to pull off with SwiftUI than an app like AirBnB that brings has its own design aesthetic and establishes its own conventions – cooperating closely with your designers and keeping them aware of what's easy/hard is a much better use of your time than trying to rewrite a pixel perfect `UISearchController` clone.

That said, navigation remains a complete mess and I hope that's a top priority for iOS 16.

[1]: You might find this relevant to your interest if you write SwiftUI for a living: https://movingparts.io/variadic-views-in-swiftui

robert-boehnke commented on Monkey Island PC-speaker music player thanassis.space/monkeyisl... · Posted by u/ttsiodras

codetrotter · 4 years ago

Wait, is it just me or does either of these two more recent songs sound a lot like the first one of those Monkey Island songs?

ItaloBrothers - Stamp on the ground. 2009. https://youtu.be/cHcVU5cGUNE

Basshunter - DotA. 2008. https://youtu.be/qTsaS1Tm-Ic

robert-boehnke · 4 years ago

I don't hear it myself but you might be interested to learn that the DotA song derives from 2000's Daddy DJ by the band of the same name https://www.youtube.com/watch?v=flL_2awF-QI

robert-boehnke commented on In big tech’s dystopia, cat videos earn millions while real artists beg for tips theguardian.com/commentis... · Posted by u/hardmaru

greenmana · 4 years ago

What would make me happy, both as a consumer and a musician, is that if I only listen to my favorite artist for the whole month, then 75 % of my monthly subscription money would go directly to said artist, and not Taylor Swift or what ever is the current "most popular pool".

robert-boehnke · 4 years ago

Without Taylor Swift (or any other big name major label artist), Spotify might not be a viable business though.

Taylor Swift may argue that she's entitled to a better deal since she drives traffic, similar to how Apple Stores can negotiate better rents in shopping malls.

robert-boehnke commented on Cameras and Lenses ciechanow.ski/cameras-and... · Posted by u/robert-boehnke

temp42020 · 5 years ago

This was posted less than one minute after the author tweeted about it https://twitter.com/BCiechanowski/status/1335983449786654723. Judging from OP's most recent submissions he must find it a good way to harvest some karma by using tweet alerts.

robert-boehnke · 5 years ago

I set up the tweet alert thanks to the algorithmic timeline and Bartosz' low post volume but I appreciate your concern.